The 'PCGP Germline Variant Search' tool searches chromosomes for SNPs at specific positions within published PCGP patients.

Note: The genomic coordinates system used by this tool has been switched from HG18 to HG19. Please use this link to convert genomic coordinates to HG19 assembly.

Note: This tool searches for SNP matches at the specified chromosomal positions in the published PCGP patients for following diseases: T-ALL, RB and MB.

Please upload or enter 100 or fewer chromosomal positions using HG19 assembly in the left section to begin the search.

The supported formats for chromosomal positions are mentioned below. Please note that usage of 'chr' text is optional.

  • 1:10013
  • 9;205501
  • 18.18519320
  • X-155260360

An example output for HG19 - chr15.20006778 chromosomal position search is mentioned below:

Total Records: 6
Name
  • Exact/Wild Card matches
  • Sort Asc
  • Sort Desc
  • Graph Column
Chr
  • Exact/Wild Card matches
  • Sort Asc
  • Sort Desc
  • Graph Column
Position
  • Exact/Wild Card matches
  • Sort Asc
  • Sort Desc
  • Graph Column
  • Numeric Filter
Chr Allele
  • Exact/Wild Card matches
  • Sort Asc
  • Sort Desc
  • Graph Column
Alt Allele
  • Exact/Wild Card matches
  • Sort Asc
  • Sort Desc
  • Graph Column
Genomic Context
  • Exact/Wild Card matches
  • Sort Asc
  • Sort Desc
  • Graph Column
chr15.20006778 chr15 20006778 C A AACTCTGTGAGATGAATGCA[C/A]ACATCACAAAGAAGTTTCTC
chr15.20006778 chr15 20006778 C A AACTCTGTGAGATGAATGCA[C/A]ACATCACAACGAAGTTTCTC
chr15.20006778 chr15 20006778 C G AACTCTGTGAGATGAATGCA[C/G]ACATCACAAAGAAGTTTCTC
chr15.20006778 chr15 20006778 C G AACTCTGTGAGATGAATGCA[C/G]ACATCACAACGAAGTTTCTC
chr15.20006778 chr15 20006778 C T AACTCTGTGAGATGAATGCA[C/T]ACATCACAAAGAAGTTTCTC
chr15.20006778 chr15 20006778 C T AACTCTGTGAGATGAATGCA[C/T]ACATCACAACGAAGTTTCTC
1 of 1 Pages
Loading... Your browser is loading the next resultset

PCGP Explore - What's New

Click here to view Release Notes
Stop Spinner
Unreasonably Slow?
Give us feedback.